Powered by SafeDNA API

Biosecurity
Intelligence Platform

Two powerful tools for modern biosecurity compliance — real-time DNA sequence hazard screening and AI-powered dual-use research risk analysis.

LIVE SEQUENCE ANALYSIS
ATGAAAGCAATTTTTGTCTTGTTCGCTGTGCTTTCTTCAGTTGTTTCAGCATCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAATGAAAGCAATTTTTGTCTTGTTCGCTGTGCTTTCTTCAGTTGTTTCAGCATCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAATGAAAGCAATTTTTGTCTTGTTCGCTGTGCTTTCTTCAGTTGTTTCAGCATCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAATGAAAGCAATTTTTGTCTTGTTCGCTGTGCTTTCTTCAGTTGTTTCAGCATCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCAGCA
GRANTED
10M+
Sequences Screened
<2s
Average Response Time
99.9%
Uptime SLA
180+
Countries Supported
DNA Sequence Screening

Screen sequences for
biosecurity hazards

Submit any DNA sequence and receive an instant synthesis permission decision — Granted or Denied — backed by the SafeDNA hazard database covering select agents, toxins, and potential pandemic pathogens. Your sequences are never exposed thanks to cryptographic privacy protocols.

1
Paste your FASTA sequence or raw nucleotides
2
Cryptographic screening against the SafeDNA hazard database
3
Receive synthesis permission with full hazard breakdown
4
Download PDF report or share a secure link with collaborators
pUC19 PlasmidSynthesis Granted
ATGAAAGCAATTTTTGTCTTGTTCGCTGTGCTTTCTTCAG
0 hazard hits · 2,686 bp · 1.2s
Unknown SequenceSynthesis Denied
GAATCGCAATTAACAATAACTAAAGAGAAAAAAGAAGAAC
2 hazard hits·Influenza A (H1N1) · SelectAgent
HIT REGION MAP
0 bp5,000 bp10,000 bp

Real-Time Hazard Detection

Instantly screen against the SafeDNA hazard database covering select agents, toxins, and potential pandemic pathogens.

Cryptographic Privacy

Your sequences are never exposed. SafeDNA uses cryptographic protocols so hazard databases can be queried without revealing sequence content.

Interactive Visualizations

Explore results with hit region maps, organism breakdowns, and nucleotide-level hazard annotations.

PDF & JSON Reports

Download formatted PDF reports for compliance records or export machine-readable JSON for downstream workflows.

Full Screening History

Audit trail of all screening requests with filterable history, status tracking, and result archiving.

Secure Share Links

Generate time-limited shareable links to send results to external collaborators without requiring login.

DURC Identification

Identify dual-use research
before it causes harm

Upload a research paper, lab protocol, or proposal and our AI engine evaluates it against all 15 US Policy DURC categories — detecting research that could be misused to enhance pathogen transmissibility, virulence, drug resistance, or immune evasion.

1
Upload PDF, DOCX, or paste research text (multi-language OCR supported)
2
AI engine evaluates against 15 DURC categories
3
Receive a risk score (0–100) with concern evidence
4
Download ethics board report with safety recommendations
H5N1 Transmission Study
Research Paper · 24 pages
CRITICAL RISK
0 — Safe87 / 100100 — Critical
Enhanced transmissibility via gain-of-function
Airborne transmission potential identified
Vaccine resistance implications
SAFETY RECOMMENDATIONS
Escalate to BSL-4 containment level
Restrict access to cleared personnel only
Remove transmission data before publication
Submit for institutional ethics review

AI-Powered Risk Assessment

Large language model evaluates research against all 15 US DURC policy categories with evidence-backed concern identification.

Multi-Format Document Upload

Upload PDF or DOCX files with automatic text extraction. Scanned documents are processed via Tesseract OCR.

Multi-Language OCR

Extract text from scanned PDFs in English, French, German, and Arabic with confidence scoring per language.

0–100 Risk Score

Quantified risk score with Low / Medium / High / Critical classification and visual gauge for instant comprehension.

Prioritized Recommendations

Actionable safety recommendations ranked by priority — from lab containment upgrades to publication redaction guidance.

Ethics Board PDF Reports

Generate formatted PDF reports with risk score, concern evidence, and recommendations ready for institutional ethics review.

Two tools, one platform

Choose the right tool for your biosecurity workflow.

DNA Sequence Screening
For synthesis providers & researchers
Submit FASTA or raw nucleotide sequences
Instant synthesis permission decision
Nucleotide-level hazard hit mapping
Organism & accession number details
Shareable result links for collaborators
Full audit history & queue management
DURC Identification
For IRBs, ethics boards & institutions
Upload PDF, DOCX, or paste research text
AI analysis against 15 DURC categories
0–100 risk score with severity classification
Evidence-backed concern identification
Prioritized safety recommendations
Ethics board PDF report generation

Built for serious biosecurity work

Both tools share enterprise-grade infrastructure.

End-to-End Security
Cryptographic privacy on all sequence data
Role-Based Access
Admin and user roles with granular permissions
Full Audit Trail
Complete history of all analyses and actions
Real-Time Processing
Sub-2 second response times on all requests
FAQ

Questions & Answers

Everything you need to know about SafeDNA, biosecurity screening, and DURC compliance.

Start your free trial today

1-day free trial. Then $10/month for full access to both DNA Screening and DURC Analysis.